Prolifererende cel nucleair  antigen  direct met androgene  receptoren

uwvrijheid

uwvrijheid

Een raamwerk voor sterk gemultiplexte dextramer mapping en voorspelling van T-  celreceptorsequenties  voor  antigeenspecificiteit  particular

T-celreceptor (TCR) antigeenspecifieke herkenning is essentieel voor het adaptieve immuunsysteem. Het bouwen van een TCR-antigeen-interactiekaart was echter een uitdaging vanwege de duizelingwekkende diversiteit van TCR’s en antigenen. Dienovereenkomstig zijn recentelijk sterk gemultiplexte dextrameer-TCR-bindingsassays ontwikkeld, maar het nut van de daaruit voortvloeiende grote datasets wordt beperkt door het ontbreken van robuuste rekenmethoden voor normalisatie en interpretatie.

Hier presenteren we een computationeel raamwerk dat een nieuwe methode omvat, ICON (Integrative CONtext-specific Normalization) , voor het identificeren van betrouwbare TCR-pMHC (peptide-major histocompatibiliteitscomplex) interacties en een op neurale netwerk gebaseerde classificatie TCRAI die beter presteert dan andere state-of- geavanceerde methoden voor het voorspellen van TCR-antigeenspecificiteit. We hebben verder aangetoond dat we door ICON en TCRAI te combineren nieuwe subgroepen van TCR ‘s kunnen ontdekken die through verschillende mechanismen aan een bepaalde pMHC binden . Ons raamwerk vergemakkelijkt de identificatie en het begrip van TCR-antigeen-specifieke interacties voor fundamenteel immunologisch onderzoek en klinische immuunmonitoring.

Kwantificeren persistentie in de T-celsignalering netwerk through een optisch bestuurbaar  antigen  receptor

T-cellen maken onderscheid tussen gezonde en geïnfecteerde cellen met een opmerkelijke gevoeligheid bij het opzetten van een immuunrespons, waarvan wordt aangenomen dat deze afhankelijk is van T-cellen die stimuli van meerdere antigeenpresenterende celinteracties combineren tot een krachtigere respons. Om het vermogen van T-cellen om dit te bereiken te kwantificeren, hebben we een antigeenreceptor ontwikkeld die optisch afstembaar is binnen celconjugaten, die controle geeft over de duur en intensiteit van intracellulaire T-celsignalering.

We observeren een beperkte persistentie binnen het intracellulaire netwerk van T-cellen bij verstoring van de receptorinvoer, waarbij signalen volledig verdwijnen in ~ 15 minuten, en tonen direct aan dat aanhoudende proximale receptorsignalering vereist is om gentranscriptie te behouden. T-cellen accumuleren dus voornamelijk de output van genexpressie in plaats van discrete intracellulaire signalen te integreren. Door optische controle te ontwikkelen in een klinisch relevante chimere antigeenreceptor (CAR), laten we zien dat deze beperkte signaalpersistentie kan worden benut om CAR-T-celactivering drievoudig te verhogen met behulp van pulserende stimulatie. Onze resultaten zijn waarschijnlijk meer in het algemeen van toepassing op de signaleringsdynamiek van andere cellulaire netwerken.

uwvrijheid
uwvrijheid

DSTNP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723393 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723399 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723405 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723411 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723417 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723423 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723429 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723435 1.0 ug DNA Ask for price

DUTP6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723441 1.0 ug DNA Ask for price

DUTP7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723447 1.0 ug DNA Ask for price

DUTP8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723453 1.0 ug DNA Ask for price

DUX4L8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723459 1.0 ug DNA Ask for price

DUX4L10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723465 1.0 ug DNA Ask for price

DUX4L11 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723471 1.0 ug DNA Ask for price

DUX4L14 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723477 1.0 ug DNA Ask for price

DUX4L16 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723483 1.0 ug DNA Ask for price

DUX4L17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723489 1.0 ug DNA Ask for price

DUX4L18 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723495 1.0 ug DNA Ask for price

DUX4L19 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723501 1.0 ug DNA Ask for price

DUXB Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723507 1.0 ug DNA Ask for price

DVL1L1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723513 1.0 ug DNA Ask for price

DWS Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723519 1.0 ug DNA Ask for price

DYNLL1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723525 1.0 ug DNA Ask for price

DYRK1AIP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723531 1.0 ug DNA Ask for price

DYRK1AIP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723537 1.0 ug DNA Ask for price

DYT2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723543 1.0 ug DNA Ask for price

DYT4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723549 1.0 ug DNA Ask for price

DYT7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723555 1.0 ug DNA Ask for price

DYT10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723561 1.0 ug DNA Ask for price

DYT13 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723567 1.0 ug DNA Ask for price

DYT15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723573 1.0 ug DNA Ask for price

DYT17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723579 1.0 ug DNA Ask for price

DYT21 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723585 1.0 ug DNA Ask for price

DYT22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723591 1.0 ug DNA Ask for price

DYX1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723597 1.0 ug DNA Ask for price

DYX2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723609 1.0 ug DNA Ask for price

DYX3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723615 1.0 ug DNA Ask for price

DYX4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723621 1.0 ug DNA Ask for price

DYX5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723627 1.0 ug DNA Ask for price

DYX6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723633 1.0 ug DNA Ask for price

DYX7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723639 1.0 ug DNA Ask for price

DYX8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723645 1.0 ug DNA Ask for price

DYX9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723651 1.0 ug DNA Ask for price

E2F3P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723663 1.0 ug DNA Ask for price

E2F4P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723669 1.0 ug DNA Ask for price

E11S Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723675 1.0 ug DNA Ask for price

EBM Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723687 1.0 ug DNA Ask for price

EBR3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723693 1.0 ug DNA Ask for price

EBR4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723699 1.0 ug DNA Ask for price

EBVM1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723705 1.0 ug DNA Ask for price

EBVS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723711 1.0 ug DNA Ask for price

ECA1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723717 1.0 ug DNA Ask for price

ECEL1P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723723 1.0 ug DNA Ask for price

ECEL1P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723729 1.0 ug DNA Ask for price

EDDM3DP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723735 1.0 ug DNA Ask for price

EEC1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723741 1.0 ug DNA Ask for price

EEC2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723747 1.0 ug DNA Ask for price

EEF1A1P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723753 1.0 ug DNA Ask for price

EEF1A1P4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723759 1.0 ug DNA Ask for price

EEF1A1P15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723765 1.0 ug DNA Ask for price

EEF1A1P16 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723771 1.0 ug DNA Ask for price

EEF1A1P17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723777 1.0 ug DNA Ask for price

EEF1A1P18 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723783 1.0 ug DNA Ask for price

EEF1A1P22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723789 1.0 ug DNA Ask for price

EEF1A1P23 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723795 1.0 ug DNA Ask for price

EEF1A1P25 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723801 1.0 ug DNA Ask for price

EEF1A1P26 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723807 1.0 ug DNA Ask for price

EEF1A1P28 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723813 1.0 ug DNA Ask for price

EEF1A1P29 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723819 1.0 ug DNA Ask for price

EEF1A1P30 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723825 1.0 ug DNA Ask for price

EEF1A1P31 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723831 1.0 ug DNA Ask for price

EEF1A1P33 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723837 1.0 ug DNA Ask for price

EEF1A1P34 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723843 1.0 ug DNA Ask for price

EEF1A1P35 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723849 1.0 ug DNA Ask for price

EEF1A1P38 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723855 1.0 ug DNA Ask for price

EEF1A1P40 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723861 1.0 ug DNA Ask for price

EEF1A1P41 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723867 1.0 ug DNA Ask for price

EEF1A3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723873 1.0 ug DNA Ask for price

EEF1B2P5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723879 1.0 ug DNA Ask for price

EEF1DP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723885 1.0 ug DNA Ask for price

EEF1DP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723891 1.0 ug DNA Ask for price

EEGV1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723897 1.0 ug DNA Ask for price

EGI Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723933 1.0 ug DNA Ask for price

EIF2AP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723951 1.0 ug DNA Ask for price

EIF2AP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723957 1.0 ug DNA Ask for price

EIF2AP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723963 1.0 ug DNA Ask for price

EIF2AP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723969 1.0 ug DNA Ask for price

EIF2S2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723987 1.0 ug DNA Ask for price

EIF2S2P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723993 1.0 ug DNA Ask for price

EIF2S2P6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723999 1.0 ug DNA Ask for price

Tumorafstotende eigenschappen van gp100  209- specifieke T-cellen correleren met T-  celreceptorbindingsaffiniteit  voor het wildtype in plaats van anker-gemodificeerd  antigeen

Hoewel er uitzonderingen en uitschieters zijn, correleren T-cel-functionele responsen in het algemeen met de affiniteit van een TCR voor een peptide/MHC-complex. In een latest beschreven uitschietergeval bond de meest veelbelovende klinische kandidaat in een reeks van TCR’s die specifiek zijn voor het gp100 209  melanoomantigeen met de zwakste oplossingsaffiniteit en produceerde de minste hoeveelheid cytokine in vitro. Hypothesen voor dit uitbijtergedrag omvatten ongebruikelijke cytokine-expressiepatronen die voortkomen uit een atypische TCR-bindinggeometrie. Door dit geval in meer element te bestuderen, ontdekten we hier dat uitbijtergedrag niet te wijten is aan ongebruikelijke cytokinepatronen of TCR-binding, maar aan het gebruik van een positie 2-anker-gemodificeerde peptidevariant in in vitro experimenten in plaats van het wildtype antigeen dat aanwezig is in levend.

Hoewel de met anker gemodificeerde variant op grote schaal is gebruikt in de basis- en klinische immunologie als een surrogaat voor het wildtype peptide, heeft eerder werk aangetoond dat TCR’s duidelijk onderscheid kunnen maken tussen de twee. We laten zien dat wanneer rekening wordt gehouden met deze differentiële herkenning, de functionele eigenschappen van gp100 209- specifieke TCR’s volgen met hun affiniteit voor het peptide/MHC-complex. Naast het aantonen van de correlaten met T-celfunctie voor een klinisch relevante TCR , bieden onze resultaten belangrijke overwegingen voor de selectie van TCR’s voor immunotherapie en het gebruik van gemodificeerde peptiden in de immunologie.

Prolifererende cel nucleair  antigen  direct met androgene  receptoren  en verbetert androgeen  receptor gemedieerde signalering

Androgeenreceptor (AR) en/of zijn constitutief actieve splitsingsvarianten (AR-V’s), zoals AR-V7 en ARv567es, zijn vereist voor de groei en overleving van prostaatkankercellen en de progressie van kanker. Prolifererend celkernantigeen (PCNA) wordt bij voorkeur tot overexpressie gebracht in alle kankers en voert zijn functies uit door interactie met talrijke partnereiwitten. Het doel van de huidige studie was om de mogelijke rol van PCNA bij de regulatie van AR-activiteit te onderzoeken.

Een identieke consensussequentie van de PCNA-interacting protein-box (PIP-box) werd geïdentificeerd aan het N-uiteinde van AR-eiwitten van mens, muis en rat. Er werd gevonden dat PCNA complexen vormt met de volledige AR (AR-FL) en AR-V7, die verzwakt kunnen worden door de kleinmoleculige PIP-box-remmer, T2AA. PCNA vormt ook een complicated met ARv567es en recombinant AR-eiwit. De PCNA-remmers, PCNA-I1S en T2AA, remden de AR-transcriptieactiviteit en de expressie van AR-doelgenen in LNCaP-AI- en 22Rv1-cellen, maar niet in AR-negatieve PC-3-cellen. De knock-down van PCNA-expressieverminderde door dihydrotestosteron gestimuleerde AR-transcriptieactiviteit en schafte het remmende impact van PCNA-I1S op AR-activiteit af. De PCNA-remmer, PCNA‑I1, oefende additieve groeiremmende effecten uit met androgeendeprivatie en enzalutamide in cellen die AR‑FL of AR‑FL/AR‑V7 tot expressie brengen, maar niet in AR‑negatieve PC‑3-cellen.

Tenslotte R9-AR-PIP, een klein peptide imiterende AR PIP-box , bleek te binden aan GFP-PCNA in Ok d  van 2,73 pM en remmen de expressie van AR doelgenen, AR transcriptionele activiteit en de groei van AR tot expressie cellen. Over het geheel genomen suggereren deze gegevens sterk dat AR een PCNA-partnereiwit is en een interactie aangaat met PCNA through de PIP-box en dat het richten op de PCNA-AR-interactie een innovatieve en selectieve therapeutische strategie kan zijn tegen prostaatkanker, met identify castratieresistente prostaatkankers constitutief actieve AR-V’s tot overexpressie brengen.

Nieuwe EGFRvIII-specifieke chimere antigeenreceptor    T-cellen met hoge affiniteit  elimineren effectief humaan glioblastoom

Doelstellingen:  Het toenemende succes van chimere antigeenreceptor (CAR) T-celtherapie bij hematologische maligniteiten versterkt de toepassing ervan bij veel andere kankertypes en met hernieuwde aandacht voor de toepassing ervan op solide tumoren. We presenteren een nieuwe CAR tegen glioblastoom, een agressief, kwaadaardig glioom, met een sombere overlevingskans waarvoor de behandelingsopties al meer dan een decennium onveranderd zijn gebleven.

Methoden:  We gebruiken het humane Retained Show (ReD) antilichaamplatform (Myrio Therapeutics) om een ​​nieuw enkelketenig variabel fragment (scFv ) te identificeren dat de epidermale groeifactorreceptormutant variant III (EGFRvIII) herkent , een veel voorkomende en tumorspecifieke mutatie gevonden bij glioblastoom. We gebruiken zowel  in vitro  functionele testen als een  in vivo  orthotopisch xenograft- mannequin van glioblastoma om de functie van onze nieuwe CAR, GCT02 genaamd, te onderzoeken, gericht met behulp van muizen CAR T-cellen.

Resultaten:  Onze EGFRvIII-specifieke scFv bleek een veel hogere affiniteit te hebben dan gerapporteerde comparatoren die reverse-engineered waren op foundation van monoklonale antilichamen. Ondanks de hogere affiniteit doden GCT02 CAR T-cellen op gelijke wijze, maar scheiden ze lagere hoeveelheden cytokine af. Bovendien mediëren GCT02-CAR T-cellen ook snelle en volledige tumoreliminatie  in vivo .

Conclusie:  We presenteren een nieuwe EGFRvIII-specifieke CAR, met effectieve antitumorfuncties , zowel  in vitro  als in een xenotransplantaatmodel van humaan glioblastoom.

CORNING® REUSABLE PHENOLIC GPI 28-400 THREADED SCREW CAP WITH RUBBER LINER
9999-28 144/pk
EUR 240
Description: General Apparatus; Stoppers
Mouse pre-microRNA Expression Construct mir-28
MMIR-28-PA-1 Bacterial Streak
EUR 684
  • Category: MicroRNA Tools
EBAG9 siRNA
20-abx901624
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EBAG9 siRNA
20-abx914879
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EBAG9 siRNA
20-abx914880
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EBAG9 antibody
70R-9916 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EBAG9 antibody
EBAG9 Antibody
ABD6703 100 ug
EUR 438
EBAG9 antibody
38323-100ul 100ul
EUR 252
EBAG9 antibody
70R-16981 50 ul
EUR 435
Description: Rabbit polyclonal EBAG9 antibody
EBAG9 Antibody
DF6703 200ul
EUR 304
Description: EBAG9 Antibody detects endogenous levels of total EBAG9.
EBAG9 Antibody
1-CSB-PA007355GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EBAG9. Recognizes EBAG9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
EBAG9 protein (His tag)
80R-1093 100 ug
EUR 224
Description: Purified recombinant Human EBAG9 protein
CMV (Cytomegalovirus Antibody IgG) ELISA test
28 96T/Box Ask for price
  • Area of application: Prepotency testing
Description: ELISA based test for quantitative detection of CMV (Cytomegalovirus Antibody IgG)
RNU6-28 Recombinant Protein (Human)
RP089073 100 ug Ask for price
Recombinant HPV-28 E1 Protein
VAng-Wyb3131-inquire inquire Ask for price
Description: Human papillomavirus type 28 Replication protein E1, recombinant protein.
Recombinant HPV-28 L1 Protein
VAng-Wyb3136-inquire inquire Ask for price
Description: Human papillomavirus type 28 Major capsid protein L1, recombinant protein.
EBAG9 Conjugated Antibody
C38323 100ul
EUR 397
EBAG9 cloning plasmid
CSB-CL007355HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 642
  • Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaaga
  • Show more
Description: A cloning plasmid for the EBAG9 gene.
EBAG9 cloning plasmid
CSB-CL007355HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 642
  • Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaaga
  • Show more
Description: A cloning plasmid for the EBAG9 gene.
EBAG9 Rabbit pAb
A1935-100ul 100 ul
EUR 308
EBAG9 Rabbit pAb
A1935-200ul 200 ul
EUR 459
EBAG9 Rabbit pAb
A1935-20ul 20 ul
EUR 183
EBAG9 Rabbit pAb
A1935-50ul 50 ul
EUR 223
EBAG9 Rabbit pAb
A8385-100ul 100 ul
EUR 308
EBAG9 Rabbit pAb
A8385-200ul 200 ul
EUR 459
EBAG9 Rabbit pAb
A8385-20ul 20 ul Ask for price
EBAG9 Rabbit pAb
A8385-50ul 50 ul Ask for price
EBAG9 Blocking Peptide
33R-2039 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EBAG9 antibody, catalog no. 70R-9916
Human EBAG9 Antibody
32605-05111 150 ug
EUR 261
EBAG9 Blocking Peptide
DF6703-BP 1mg
EUR 195
Anti-EBAG9 Antibody
PB9553 100ug/vial
EUR 334
pCMV-SPORT6-EBAG9
PVT13493 2 ug
EUR 391
Anti-EBAG9 antibody
STJ110683 100 µl
EUR 277
Description: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10.
Anti-EBAG9 antibody
STJ23462 100 µl
EUR 277
Description: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10.
Anti-EBAG9 (4A10)
YF-MA16699 100 ug
EUR 363
Description: Mouse monoclonal to EBAG9
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-100ug
QP5959-ec-100ug 100ug
EUR 408
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-10ug
QP5959-ec-10ug 10ug
EUR 200
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-1mg
QP5959-ec-1mg 1mg
EUR 1632
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-200ug
QP5959-ec-200ug 200ug
EUR 634
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-500ug
QP5959-ec-500ug 500ug
EUR 1060
Recombinant Human RCAS1/ EBAG9 Protein, His-SUMO, E.coli-50ug
QP5959-ec-50ug 50ug
EUR 263
Matrix Metalloproteinase-28 (Recombinant)
20-abx073425
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
IL-28, human recombinant
4978-1000
EUR 5204
IL-28, human recombinant
4978-20
EUR 294
Recombinant Keratin 28 (KRT28)
4-RPS214Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: A6BLY7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 80.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Keratin 28 expressed in: E.coli
Recombinant Human Vacuolar Protein Sorting 28
7-06871 10µg Ask for price
Recombinant Human Vacuolar Protein Sorting 28
7-06872 50µg Ask for price
Recombinant Human Vacuolar Protein Sorting 28
7-06873 1mg Ask for price
Polyclonal EBAG9 Antibody (Center)
APR04492G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EBAG9 (Center). This antibody is tested and proven to work in the following applications:
Polyclonal EBAG9 Antibody (Center)
APR06938G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EBAG9 (Center). This antibody is tested and proven to work in the following applications:
Mouse EBAG9 shRNA Plasmid
20-abx974569
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat EBAG9 shRNA Plasmid
20-abx989010
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human EBAG9 shRNA Plasmid
20-abx956064
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-EBAG9 / RCAS1 antibody
STJ70947 100 µg
EUR 359
MMP28 Matrix Metalloproteinase-28 Human Recombinant Protein
PROTQ9H239 Regular: 20ug
EUR 317
Description: MMP28 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 421 amino acids (123-520a.a) and having a molecular mass of 47.3kDa. MMP28 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
PRSS28 Protease Serine 28 Mouse Recombinant Protein
PROTQ924N9 Regular: 5ug
EUR 317
Description: PRSS28 Mouse Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 256 amino acids (27-274a.a.) and having a molecular mass of 28.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa)._x000D_PRSS28 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
Recombinant CD155 Protein (Asp 28-Asn 343)
VAng-1181Lsx-100g 100 µg
EUR 1013
Description: Rhesus macaque CD155 is expressed in HEK 293 cells. (Uniprot ID: Q0MSE6-1)
Recombinant CD155 Protein (Asp 28-Asn 343)
VAng-1181Lsx-1mg 1 mg
EUR 6402
Description: Rhesus macaque CD155 is expressed in HEK 293 cells. (Uniprot ID: Q0MSE6-1)
Recombinant Erythropoietin Protein (Ala 28-Arg 193)
VAng-1516Lsx-20g 20 µg
EUR 594
Description: Human Erythropoietin (EPO) is expressed in HEK 293 cells. (Uniprot ID: AAH93628.1)
Recombinant Erythropoietin Protein (Ala 28-Arg 193)
VAng-1516Lsx-50g 50 µg
EUR 1013
Description: Human Erythropoietin (EPO) is expressed in HEK 293 cells. (Uniprot ID: AAH93628.1)
Recombinant Rat ALCAM Protein (aa 28-583)
VAng-2940Lsx-100g 100 µg
EUR 7254
Description: Recombinant Rat ALCAM is expressed in cell free expression systems. (Uniprot ID: O35112)
Recombinant Rat ALCAM Protein (aa 28-583)
VAng-2940Lsx-50g 50 µg
EUR 4765
Description: Recombinant Rat ALCAM is expressed in cell free expression systems. (Uniprot ID: O35112)
Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-100g 100 µg
EUR 1150
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-1mg 1 mg
EUR 3913
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Rabbit ALCAM Protein (aa 28-527)
VAng-2947Lsx-500g 500 µg
EUR 2663
Description: Recombinant Rabbit ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-1mg 1 mg
EUR 3390
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-200g 200 µg
EUR 1370
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Human ALCAM Protein (aa 28-516)
VAng-2950Lsx-500g 500 µg
EUR 2223
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Bovine ALCAM Protein (aa 28-527)
VAng-2957Lsx-1mg 1 mg
EUR 5852
Description: Recombinant Bovine ALCAM is expressed in E. coli. (Uniprot ID: Q9BH13)
Recombinant Bovine ALCAM Protein (aa 28-527)
VAng-2957Lsx-500g 500 µg
EUR 3583
Description: Recombinant Bovine ALCAM is expressed in E. coli. (Uniprot ID: Q9BH13)
Recombinant Mouse ALCAM Protein (aa 28-527)
VAng-2959Lsx-500g 500 µg
EUR 6415
Description: Recombinant Mouse ALCAM is expressed in HEK 293 Cells. (Uniprot ID: Q61490)
Recombinant Mouse ALCAM Protein (aa 28-527)
VAng-2959Lsx-50g 50 µg
EUR 1246
Description: Recombinant Mouse ALCAM is expressed in HEK 293 Cells. (Uniprot ID: Q61490)
Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-1mgEcoli 1 mg (E. coli)
EUR 2577
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.
Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-500gEcoli 500 µg (E. coli)
EUR 1747
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.
Recombinant Salmonella leuL Protein (aa 1-28)
VAng-Wyb0496-50gEcoli 50 µg (E. coli)
EUR 1197
Description: Salmonella typhi Leu operon leader peptide, recombinant protein.
VPS28 Vacuolar Protein Sorting 28 Human Recombinant Protein
PROTQ9UK41 Regular: 50ug
EUR 317
Description: VPS28 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 221 amino acids (1-221 a.a.) and having a molecular mass of 25.4kDa.;The VPS28 is purified by proprietary chromatographic techniques.
EBAG9 Protein Vector (Mouse) (pPB-C-His)
PV174238 500 ng
EUR 603
EBAG9 Protein Vector (Mouse) (pPB-N-His)
PV174239 500 ng
EUR 603
EBAG9 Protein Vector (Mouse) (pPM-C-HA)
PV174240 500 ng
EUR 603
EBAG9 Protein Vector (Mouse) (pPM-C-His)
PV174241 500 ng
EUR 603
EBAG9 Protein Vector (Human) (pPB-C-His)
PV013461 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPB-N-His)
PV013462 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-HA)
PV013463 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-His)
PV013464 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPB-C-His)
PV013465 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPB-N-His)
PV013466 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-HA)
PV013467 500 ng
EUR 329
EBAG9 Protein Vector (Human) (pPM-C-His)
PV013468 500 ng
EUR 329
EBAG9 Protein Vector (Rat) (pPB-C-His)
PV265294 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPB-N-His)
PV265295 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPM-C-HA)
PV265296 500 ng
EUR 603
EBAG9 Protein Vector (Rat) (pPM-C-His)
PV265297 500 ng
EUR 603
Human EBAG9 Antibody (Biotin Conjugate)
32605-05121 150 ug
EUR 369
EBAG9 ORF Vector (Human) (pORF)
ORF003366 1.0 ug DNA
EUR 95
EBAG9 ORF Vector (Human) (pORF)
ORF003367 1.0 ug DNA
EUR 95
Ebag9 ORF Vector (Rat) (pORF)
ORF066324 1.0 ug DNA
EUR 506
Ebag9 ORF Vector (Mouse) (pORF)
ORF043560 1.0 ug DNA
EUR 506
EBAG9 ELISA Kit (Human) (OKCA02302)
OKCA02302 96 Wells
EUR 930
Description: Description of target: May participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.195 U/mL.
EBAG9 ELISA Kit (Human) (OKEH05822)
OKEH05822 96 Wells
EUR 662
Description: Description of target: May participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39U/L
TRIM28 Tripartite Motif Containing 28 Human Recombinant Protein
PROTQ13263 Regular: 20ug
EUR 317
Description: TRIM28 Human Recombinant produced in E. Coli is a single polypeptide chain containing 460 amino acids (366-802) and having a molecular mass of 48.7 kDa.;TRIM28 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Recombinant ALCAM Protein (Trp 28-Ala 526) [Fc]
VAng-0714Lsx-1mg 1 mg
EUR 2745
Description: Human ALCAM, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: NP_001618)
Recombinant ALCAM Protein (Trp 28-Ala 526) [Fc]
VAng-0714Lsx-200g 200 µg
EUR 793
Description: Human ALCAM, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: NP_001618)
Recombinant ALCAM Protein (Trp 28-Ala 526) [His]
VAng-0715Lsx-1mg 1 mg
EUR 2580
Description: Human ALCAM, His tag, is expressed in HEK 293 cells. (Uniprot ID: Q13740-1)
Recombinant ALCAM Protein (Trp 28-Ala 526) [His]
VAng-0715Lsx-200g 200 µg
EUR 738
Description: Human ALCAM, His tag, is expressed in HEK 293 cells. (Uniprot ID: Q13740-1)
Recombinant CD31 Protein (Gln 28-Lys 601) [Fc]
VAng-1265Lsx-1mg 1 mg
EUR 4009
Description: Human CD31, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: AAH22512.1)
Recombinant CD31 Protein (Gln 28-Lys 601) [Fc]
VAng-1265Lsx-200g 200 µg
EUR 985
Description: Human CD31, Fc tag, is expressed in HEK 293 cells. (Uniprot ID: AAH22512.1)
Recombinant CD31 Protein (Gln 28-Lys 601) [His]
VAng-1266Lsx-100g 100 µg
EUR 738
Description: Human CD31, His tag, is expressed in HEK 293 cells. (Uniprot ID: P16284-1)
Recombinant CD31 Protein (Gln 28-Lys 601) [His]
VAng-1266Lsx-1mg 1 mg
EUR 4009
Description: Human CD31, His tag, is expressed in HEK 293 cells. (Uniprot ID: P16284-1)
Recombinant CNDP1 Protein (Ser 28-His 508) [His]
VAng-1408Lsx-1mg 1 mg
EUR 5274
Description: Human CNDP1, His tag, is expressed in HEK 293 cells. (Uniprot ID: AAI17123)
Recombinant CNDP1 Protein (Ser 28-His 508) [His]
VAng-1408Lsx-50g 50 µg
EUR 848
Description: Human CNDP1, His tag, is expressed in HEK 293 cells. (Uniprot ID: AAI17123)
Recombinant ErbB3 Protein (Leu 28-Gly 232) [His]
VAng-1507Lsx-200g 200 µg
EUR 3844
Description: Human ErbB3 (Her3), His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_004420)
Recombinant ErbB3 Protein (Leu 28-Gly 232) [His]
VAng-1507Lsx-25g 25 µg
EUR 1013
Description: Human ErbB3 (Her3), His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_004420)
Recombinant Human ALCAM Protein (aa 28-527) [His]
VAng-2951Lsx-1mg 1 mg
EUR 2498
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Human ALCAM Protein (aa 28-527) [His]
VAng-2951Lsx-200g 200 µg
EUR 916
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Human ALCAM Protein (aa 28-527) [His]
VAng-2951Lsx-500g 500 µg
EUR 1700
Description: Recombinant Human ALCAM is expressed in E. coli. (Uniprot ID: Q13740)
Recombinant Human ALCAM Protein (aa 28-526) [Fc]
VAng-2953Lsx-10g 10 µg
EUR 325
Description: Recombinant Human ALCAM is expressed in HEK 293 Cells. (Uniprot ID: Q13740)
Recombinant Human ALCAM Protein (aa 28-526) [Fc]
VAng-2953Lsx-50g 50 µg
EUR 518
Description: Recombinant Human ALCAM is expressed in HEK 293 Cells. (Uniprot ID: Q13740)
Recombinant Rat ALCAM Protein (aa 28-527) [His]
VAng-2954Lsx-1mg 1 mg
EUR 2675
Description: Recombinant Rat ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Rat ALCAM Protein (aa 28-527) [His]
VAng-2954Lsx-200g 200 µg
EUR 985
Description: Recombinant Rat ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Rat ALCAM Protein (aa 28-527) [His]
VAng-2954Lsx-500g 500 µg
EUR 1824
Description: Recombinant Rat ALCAM is expressed in E. coli. (Uniprot ID: O35112)
Recombinant Clostridium Sordellii Sialidase Protein (aa 28-404)
VAng-Lsx01506-1mgEcoli 1 mg (E. coli)
EUR 4590
Description: Clostridium Sordellii Sialidase, recombinant protein.
Recombinant Clostridium Sordellii Sialidase Protein (aa 28-404)
VAng-Lsx01506-500gEcoli 500 µg (E. coli)
EUR 3256
Description: Clostridium Sordellii Sialidase, recombinant protein.
Recombinant Clostridium Sordellii Sialidase Protein (aa 28-404)
VAng-Lsx01506-50gEcoli 50 µg (E. coli)
EUR 2226
Description: Clostridium Sordellii Sialidase, recombinant protein.
Recombinant Staphylococcus Aureus ssaA2 Protein (aa 28-267)
VAng-Cr6465-inquire inquire Ask for price
Description: Staphylococcus Aureus (strain Mu50 / ATCC 700699) Staphylococcal secretory antigen ssaA2 (ssaA2), recombinant protein.
Recombinant Pasteurella Multocida ahpA Protein (aa 28-226)
VAng-Cr6697-1mgEcoli 1 mg (E. coli)
EUR 3473
Description: Pasteurella Multocida (strain Pm70) Protein AhpA (ahpA), recombinant protein.
Recombinant Pasteurella Multocida ahpA Protein (aa 28-226)
VAng-Cr6697-500gEcoli 500 µg (E. coli)
EUR 2484
Description: Pasteurella Multocida (strain Pm70) Protein AhpA (ahpA), recombinant protein.
Recombinant Pasteurella Multocida ahpA Protein (aa 28-226)
VAng-Cr6697-50gEcoli 50 µg (E. coli)
EUR 1686
Description: Pasteurella Multocida (strain Pm70) Protein AhpA (ahpA), recombinant protein.
Recombinant HAdV-12 PX Protein (aa 28-42)
VAng-Cr4230-1mgEcoli 1 mg (E. coli)
EUR 2319
Description: HAdV-12 Late L2 mu core protein (PX), recombinant protein.
Recombinant HAdV-12 PX Protein (aa 28-42)
VAng-Cr4230-500gEcoli 500 µg (E. coli)
EUR 1659
Description: HAdV-12 Late L2 mu core protein (PX), recombinant protein.
Recombinant HAdV-12 PX Protein (aa 28-42)
VAng-Cr4230-50gEcoli 50 µg (E. coli)
EUR 1164
Description: HAdV-12 Late L2 mu core protein (PX), recombinant protein.
Recombinant Human ANGPTL4 Protein (aa 28-403) (Yeast)
VAng-3127Lsx-1mg 1 mg
EUR 5989
Description: Recombinant Human Angiopoietin-like 4 protein, expressed in Yeast. (Uniprot ID: Q9BY76)
Recombinant Human ANGPTL4 Protein (aa 28-403) (Yeast)
VAng-3127Lsx-500g 500 µg
EUR 3789
Description: Recombinant Human Angiopoietin-like 4 protein, expressed in Yeast. (Uniprot ID: Q9BY76)
Recombinant Human ANGPTL4 Protein (aa 28-403) (Yeast)
VAng-3127Lsx-50g 50 µg
EUR 2498
Description: Recombinant Human Angiopoietin-like 4 protein, expressed in Yeast. (Uniprot ID: Q9BY76)
Recombinant Human ANGPTL4 Protein (aa 28-403) (Baculovirus)
VAng-3128Lsx-100g 100 µg
EUR 4490
Description: Recombinant Human Angiopoietin-like 4 protein, expressed in Baculovirus. (Uniprot ID: Q9BY76)
Recombinant Human ANGPTL4 Protein (aa 28-403) (Baculovirus)
VAng-3128Lsx-500g 500 µg
EUR 5824
Description: Recombinant Human Angiopoietin-like 4 protein, expressed in Baculovirus. (Uniprot ID: Q9BY76)
Recombinant Human ANGPTL4 Protein (aa 28-403) (Baculovirus)
VAng-3128Lsx-50g 50 µg
EUR 3129
Description: Recombinant Human Angiopoietin-like 4 protein, expressed in Baculovirus. (Uniprot ID: Q9BY76)
Recombinant Human ANGPTL4 Protein (aa 28-403) [GST]
VAng-3138Lsx-50g 50 µg
EUR 820
Description: Recombinant Human Angiopoietin-like 4 protein, expressed in E. coli. (Uniprot ID: Q9BY76)
Recombinant Shigella Flexneri leuL Protein (aa 1-28)
VAng-Lsx07886-1mgEcoli 1 mg (E. coli)
EUR 2401
Description: Shigella Flexneri Leu operon leader peptide, recombinant protein.
Recombinant Shigella Flexneri leuL Protein (aa 1-28)
VAng-Lsx07886-500gEcoli 500 µg (E. coli)
EUR 1714
Description: Shigella Flexneri Leu operon leader peptide, recombinant protein.
Recombinant Shigella Flexneri leuL Protein (aa 1-28)
VAng-Lsx07886-50gEcoli 50 µg (E. coli)
EUR 1191
Description: Shigella Flexneri Leu operon leader peptide, recombinant protein.
Recombinant Shigella Flexneri nrfC Protein (aa 28-223)
VAng-Lsx07990-1mgEcoli 1 mg (E. coli)
EUR 3445
Description: Shigella Flexneri Protein nrfC, recombinant protein.
Recombinant Shigella Flexneri nrfC Protein (aa 28-223)
VAng-Lsx07990-500gEcoli 500 µg (E. coli)
EUR 2470
Description: Shigella Flexneri Protein nrfC, recombinant protein.
Recombinant Shigella Flexneri nrfC Protein (aa 28-223)
VAng-Lsx07990-50gEcoli 50 µg (E. coli)
EUR 1673
Description: Shigella Flexneri Protein nrfC, recombinant protein.
Recombinant Shigella Flexneri pagP Protein (aa 28-186)
VAng-Lsx08010-1mgEcoli 1 mg (E. coli)
EUR 3213
Description: Shigella Flexneri Lipid A palmitoyltransferase PagP, recombinant protein.
Recombinant Shigella Flexneri pagP Protein (aa 28-186)
VAng-Lsx08010-500gEcoli 500 µg (E. coli)
EUR 2305
Description: Shigella Flexneri Lipid A palmitoyltransferase PagP, recombinant protein.
Recombinant Shigella Flexneri pagP Protein (aa 28-186)
VAng-Lsx08010-50gEcoli 50 µg (E. coli)
EUR 1576
Description: Shigella Flexneri Lipid A palmitoyltransferase PagP, recombinant protein.
Recombinant Clostridium Thermocellum glmU Protein (aa 28-461)
VAng-Lsx01950-1mgEcoli 1 mg (E. coli)
EUR 5128
Description: Clostridium Thermocellum Bifunctional protein GlmU, recombinant protein.
Recombinant Clostridium Thermocellum glmU Protein (aa 28-461)
VAng-Lsx01950-500gEcoli 500 µg (E. coli)
EUR 3630
Description: Clostridium Thermocellum Bifunctional protein GlmU, recombinant protein.
Recombinant Clostridium Thermocellum glmU Protein (aa 28-461)
VAng-Lsx01950-50gEcoli 50 µg (E. coli)
EUR 2472
Description: Clostridium Thermocellum Bifunctional protein GlmU, recombinant protein.
Recombinant Clostridium Thermocellum licB Protein (aa 28-334)
VAng-Lsx01983-1mgEcoli 1 mg (E. coli)
EUR 4145
Description: Clostridium Thermocellum Beta-glucanase, recombinant protein.
Recombinant Clostridium Thermocellum licB Protein (aa 28-334)
VAng-Lsx01983-500gEcoli 500 µg (E. coli)
EUR 2940
Description: Clostridium Thermocellum Beta-glucanase, recombinant protein.
Recombinant Clostridium Thermocellum licB Protein (aa 28-334)
VAng-Lsx01983-50gEcoli 50 µg (E. coli)
EUR 2016
Description: Clostridium Thermocellum Beta-glucanase, recombinant protein.
Recombinant Escherichia coli lptA Protein (aa 28-185)
VAng-Lsx02468-1mgEcoli 1 mg (E. coli)
EUR 3294
Description: Escherichia coli Lipopolysaccharide export system protein LptA, recombinant protein.
Recombinant Escherichia coli lptA Protein (aa 28-185)
VAng-Lsx02468-500gEcoli 500 µg (E. coli)
EUR 2113
Description: Escherichia coli Lipopolysaccharide export system protein LptA, recombinant protein.
Recombinant Escherichia coli lptA Protein (aa 28-185)
VAng-Lsx02468-50gEcoli 50 µg (E. coli)
EUR 573
Description: Escherichia coli Lipopolysaccharide export system protein LptA, recombinant protein.
Recombinant Haemophilus Influenzae hifB Protein (aa 28-241)
VAng-Lsx03394-1mgEcoli 1 mg (E. coli)
EUR 3569
Description: Haemophilus Influenzae Chaperone protein hifB, recombinant protein.
Recombinant Haemophilus Influenzae hifB Protein (aa 28-241)
VAng-Lsx03394-500gEcoli 500 µg (E. coli)
EUR 2553
Description: Haemophilus Influenzae Chaperone protein hifB, recombinant protein.
Recombinant Haemophilus Influenzae hifB Protein (aa 28-241)
VAng-Lsx03394-50gEcoli 50 µg (E. coli)
EUR 1728
Description: Haemophilus Influenzae Chaperone protein hifB, recombinant protein.
Recombinant Trypanosoma Brucei PARPB Protein (aa 28-123)
VAng-Wyb8133-1mgEcoli 1 mg (E. coli)
EUR 2814
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide B-alpha protein, recombinant protein.
Recombinant Trypanosoma Brucei PARPB Protein (aa 28-123)
VAng-Wyb8133-500gEcoli 500 µg (E. coli)
EUR 2016
Description: Trypanosoma Brucei brucei Procyclic form-specific polypeptide B-alpha protein, recombinant protein.

Related Post

Leave a Reply

Your email address will not be published. Required fields are marked *