T-cellen stamcellen gemodificeerd met een vernieuwde CD30-chimeer  antigen  receptor



Onderzoek lymfoom product verkregen na infusie van piggyBac gemodificeerd CD19 chimeer  antigeen  receptor  van T-cellen

We voerden een Fase I klinische studie uit van van donor afgeleide CD19-specifieke chimere antigeenreceptor T-cellen (CAR T-cellen) voor B-celmaligniteit die recidiveerde of aanhield na gematchte gerelateerde allogene hemopoëtische stamceltransplantatie. Om de kosten en transgencapaciteitsbeperkingen van traditionele virale vectoren te overwinnen, werden CAR T-cellen geproduceerd met behulp van het piggyBac-transposonsysteem van genetische modificatie. Na CAR-T-celinfusie ontwikkelde één patiënt een geleidelijk groter wordende retroperitoneale tumor als gevolg van een CAR-expressie van CD4+ T-cellymfoom. Screening van andere patiënten leidde tot de detectie van een tweede CAR T-celtumor in thoracale para-aortische lymfeklieren bij een asymptomatische patiënt.

Analyse van het eerste lymfoom toonde een hoog aantal transgenkopieën , maar geen insertie in typische oncogenen. Er waren ook structurele veranderingen zoals een gewijzigd aantal genomische kopieën en puntmutaties die geen verband hielden met de insertieplaatsen. Transcriptoomanalyse toonde aan dat de transgenpromotor de transcriptie van omliggende regio’s opreguleerde ondanks isolatorsequenties die het transgen omringen. Duidelijke globale veranderingen in transcriptie correleerden echter voornamelijk met het aantal genkopieën in plaats van met insertieplaatsen.

Bij beide patiënten vorderde het CAR T-cel-afgeleide lymfoom en één patiënt stierf. We beschrijven de eerste twee gevallen van maligne lymfoom afgeleid van CAR-gen-gemodificeerde T-cellen. Hoewel CAR T-cellen tot op heden een benijdenswaardige staat van dienst hebben op het gebied van veiligheid, benadrukken onze resultaten de noodzaak van voorzichtigheid en regelmatige follow-up van CAR T-ontvangers, vooral wanneer nieuwe methoden voor genoverdracht worden gebruikt om genetisch gemodificeerde immuuntherapieën te creëren. De proef werd geregistreerd op www.anzctr.org.au als ACTRN12617001579381.

Geheugen T-cellen stamcellen gemodificeerd met een vernieuwde CD30-chimeer  antigen  receptor  vertonen een verhoogd antitumoreffect in Hodgkin lymfoom

Doelstellingen:  Adoptieve celtherapie (ACT) met rijpe T-cellen die zijn gemodificeerd met een chimere antigeenreceptor heeft een verbeterd resultaat voor B-celmaligniteiten aangetoond. De toepassing ervan voor andere, zoals Hodgkin-lymfoom, blijft echter een klinische uitdaging. CD30-antigeen, tot expressie gebracht in Hodgkin-lymfoomcellen, is afwezig in de meeste gezonde weefsels en vormt een ideaal doelwit van ACT voor deze ziekte. Desondanks blijft de werkzaamheid van CD30-chimere antigeenreceptor (CAR) T-cellen voor Hodgkin-lymfoom bescheiden. Hier hebben we een nieuwe CD30-CAR T ontwikkeld en getest om de werkzaamheid van CD30-CAR-therapie te verbeteren, met behulp van een targeting-epitoop in het niet-splitsbare deel van de CD30-receptor, en geheugenstam-T-cellen (T SCM) om implantatie, persistentie en antitumoractiviteit te verbeteren.

Methoden:  T SCM-achtige  culturen werden ex vivo gegenereerd en geëxpandeerd   en op dag 1 of two getransduceerd met een lentivirale vector die codeert voor de CD30-CAR. Therapeutische  in vivo-  experimenten werden uitgevoerd met NSG-muizen die waren geïnjecteerd met L540 (sc) of L428 (iv) en werden behandeld met CD30-CAR T-cellen toen de tumor werd vastgesteld.

Resultaten:  CD30-CAR T SCM-achtige  cellen gegenereerd en ex vivo geëxpandeerd  , ondanks CD30-expressie en broedermoorddoding van CD30 +  CAR T-cellen, werden niet aangetast door oplosbaar CD30 en volledig uitgeroeid Hodgkin-lymfoom  in vivo , met een hoge persistentie en langdurige immuniteit. Bovendien sterk verrijkte CD30-CAR T SCM-achtige  producten verleent een overleving voordeel  in vivo , in tegenstelling tot de meer gedifferentieerde CAR T-cellen, met een hogere tumor infiltratie en versterkt antitumoreffect.

Conclusie:  Deze studie ondersteunt het gebruik van verfijnde CD30-CAR T-cellen met hoogverrijkte T SCM-achtige  producten om de klinische werkzaamheid van CAR T voor Hodgkin-lymfoom te verbeteren.



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EBAG9 Antibody

ABD6703 100 ug
EUR 438

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

EBAG9 Blocking Peptide

33R-2039 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EBAG9 antibody, catalog no. 70R-9916

Human EBAG9 Antibody

32605-05111 150 ug
EUR 261

EBAG9 Blocking Peptide

DF6703-BP 1mg
EUR 195

EBAG9 Conjugated Antibody

C38323 100ul
EUR 397

EBAG9 cloning plasmid

CSB-CL007355HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 642
  • Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaaga
  • Show more
Description: A cloning plasmid for the EBAG9 gene.

EBAG9 cloning plasmid

CSB-CL007355HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 642
  • Sequence: atggccatcacccagtttcggttatttaaattttgtacctgcctagcaacagtattctcattcctaaagagattaatatgcagatctggcagaggacggaaattaagtggagaccaaataactttgccaactacagttgattattcatcagttcctaagcagacagatgttgaaga
  • Show more
Description: A cloning plasmid for the EBAG9 gene.

EBAG9 Rabbit pAb

A8385-100ul 100 ul
EUR 308

EBAG9 Rabbit pAb

A8385-200ul 200 ul
EUR 459

EBAG9 Rabbit pAb

A8385-20ul 20 ul Ask for price

EBAG9 Rabbit pAb

A8385-50ul 50 ul Ask for price

EBAG9 Rabbit pAb

A1935-100ul 100 ul
EUR 308

EBAG9 Rabbit pAb

A1935-200ul 200 ul
EUR 459

EBAG9 Rabbit pAb

A1935-20ul 20 ul
EUR 183

EBAG9 Rabbit pAb

A1935-50ul 50 ul
EUR 223

Anti-EBAG9 (4A10)

YF-MA16699 100 ug
EUR 363
Description: Mouse monoclonal to EBAG9

Anti-EBAG9 antibody

STJ110683 100 µl
EUR 277
Description: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10.

Anti-EBAG9 Antibody

PB9553 100ug/vial
EUR 334

Anti-EBAG9 antibody

STJ23462 100 µl
EUR 277
Description: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10.


PVT13493 2 ug
EUR 391

Chymase reagent

30C-CP1129 5 units
EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent

EUR 349

Traut's Reagent

EUR 207

MTS Reagent

EUR 990

MTS Reagent

EUR 365

MTT Reagent

EUR 180

MTT Reagent

EUR 544

BOP reagent

5-02141 25g Ask for price

BOP reagent

5-02142 100g Ask for price

Bluing Reagent

BRT030 30 ml
EUR 60

Bluing Reagent

BRT125 125 ml
EUR 63

Bluing Reagent

BRT3800 1 Gal.
EUR 184

Bluing Reagent

BRT500 500 ml
EUR 76

Bluing Reagent

BRT999 1000 ml
EUR 88

BOP reagent

A7015-100000 100 g
EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 25 g
EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

Beaucage reagent

HY-100951 10mM/1mL
EUR 126

Bradford reagent

BDE641 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

Polyclonal EBAG9 Antibody (Center)

APR04492G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EBAG9 (Center). This antibody is tested and proven to work in the following applications:

EBAG9 protein (His tag)

80R-1093 100 ug
EUR 224
Description: Purified recombinant Human EBAG9 protein

Rat EBAG9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EBAG9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal EBAG9 Antibody (Center)

APR06938G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EBAG9 (Center). This antibody is tested and proven to work in the following applications:

Human EBAG9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-EBAG9 / RCAS1 antibody

STJ70947 100 µg
EUR 359

EBAG9 Recombinant Protein (Human)

RP010096 100 ug Ask for price

EBAG9 Recombinant Protein (Human)

RP010099 100 ug Ask for price

EBAG9 Recombinant Protein (Rat)

RP198968 100 ug Ask for price

EBAG9 Recombinant Protein (Mouse)

RP130676 100 ug Ask for price

Arabidopsis Thaliana Lysate

30R-AA023 150 ug
EUR 156
Description: Arabidopsis Thaliana Plant Lysate

CMV Cell Lysate

35-1867 1 mg
EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 1 ml
EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 1 ml
EUR 394
Description: HSV2 enriched cell lysate

JM109-lysate Antibody

abx234439-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21-lysate Antibody

abx230905-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Green Algae Lysate

PABL-1306 50 ug
EUR 164

BSA (Reagent Grade)

30-AB79 1 kg
EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)

30-AB81 200 grams
EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit

30100 1KIT
EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent

EUR 207

BODIPY-Acetylene Reagent

EUR 675

Biotin reagent (HRP)

65C-CE0202 5 mg
EUR 244
Description: HRP conjugated biotin labelling reagent

Convoy? Transfection Reagent

EUR 341

Bradford Dye Reagent

0209R 100 ml
EUR 131

HAMA blocking reagent

85R-1001 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1001P 1 gram
EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1003 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent

85R-1014 50 mg
EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent

85R-1025 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent

85R-1026 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

Girard's reagent T

  • EUR 203.00
  • EUR 314.00
  • 100 g
  • 500 g
  • Shipped within 1-2 weeks.

EL Transfection Reagent

  • EUR 384.00
  • EUR 537.00
  • 0.75 ml
  • 1.5 ml
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

  • EUR 425.00
  • EUR 509.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

Alcohol, Reagent (70%)

EAS500 500 ml
EUR 79

Alcohol, Reagent (70%)

EAS999 1000 ml
EUR 101

BCA Reagent, 16ML

C144-16ML 16ML
EUR 163


Biolipidure-1002-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-1002-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-103-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-103-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-1201-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-1201-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-1301-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-1301-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-203-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-203-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-206-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-206-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-405-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement


Biolipidure-405-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Chimeer  antigeen  receptor  van T-cellen gericht CD7 bij een type met een hoog risico T-cel acute lymfoblastische leukemie

Effectieve systemische behandelingen voor recidiverende of refractaire T-cel acute lymfatische leukemie (T-ALL) zijn beperkt. Recente klinische toepassing van chimere antigeenreceptor (CAR) immunotherapie heeft succesvolle beheersing van B-celmaligniteiten door CAR-T-cellen aangetoond; het ontwerpen van CAR’s voor T-ALL blijft echter een uitdaging. Overexpressie van CD7 bij T-celmaligniteiten kan een aantrekkelijk doelwit zijn voor immunotherapie bij T-ALL. Deze studie had tot doel het veilige en effectieve gebruik van autologe CD7-CAR T-cellen (4SCAR7) voor de behandeling van T-ALL met inductiefalen bij een 11-jarige patiënt te beschrijven. Op foundation van het studieprotocol van de Chinese language Kids’s Most cancers Group-ALL (CCCG-ALL) werd minimale residuele ziekte (MRD) door flowcytometrie (FC)-analyse gedetecteerd op dag 19 en 46 van de remissie-inductie.

Aan het einde van remissie-inductiechemotherapie bereikte de patiënt morfologische volledige remissie, zij het met MRD 16,13% en RT-PCR van KMT2A-MLLT1- fusie-positief, wat op inductiefalen wees. De cerebrospinale vloeistof (CSF) was negatief voor ontploffing bij de diagnose. CAR-T-therapie en allogene transplantatie werden aanbevolen als de volgende behandelingsopties. CD3 +  -lymfocyten werden 18 dagen na de hoge dosis MTX-chemotherapie bij de patiënt verzameld door middel van leukaferese. De 4SCAR7 CD7-targeting CAR-T-cellen werden daarna gegenereerd.

De patiënt kreeg voorafgaand aan de 4SCAR7- infusie lymfodepletie-chemotherapie . Orale toediening van itraconazol en sulfamethoxazol werd uitgevoerd vanaf dag zero na infusie van CAR-T-cellen. De patiënt had geen hypotensie, hypoxie of ernstige biochemische verandering of afwijking, maar had koorts op dag 9. Hoewel graad 1 cytokine-release syndrome (CRS) werd gediagnosticeerd, werd het met succes behandeld met ibuprofen. Anti-CD7 CAR-transgenkopie-aantallen in perifeer bloed werden bepaald door qPCR, die aanvankelijk een effectieve expansie vertoonde, daarna snel daalde en op een laag niveau aanhield. Hoewel de patiënt cytopenie ondervond van dag 14 tot 21, bereikte de patiënt remissie op dag 17. Na volledige remissie ontving de patiënt hematopoëtische stamceltransplantatie (HSCT) en is tot op heden goed hersteld. Over het algemeen suggereerde dit rapport dat 4SCAR7 een veilige en effectieve strategie zou kunnen zijn voor de behandeling van pediatrische patiënten met T-cel-maligniteiten met een hoog risico.

Affected person Reported Outcomes for Most cancers Patiënten met hematologische maligniteiten ondergaan Chimeer  Antigeen  Receptor  T Cell Remedy: een systematische overview

Databases werden doorzocht om onderzoeken te identificeren die in de afgelopen 10 jaar zijn gepubliceerd en die het nut van door de patiënt gerapporteerde uitkomsten (PRO’s) onderzochten bij patiënten die chimere antigeenreceptor (CAR) T-celtherapie kregen bij patiënten met hematologische maligniteiten. Van de 280 information kwamen drie artikelen over 206 patiënten in aanmerking. De gegevens zijn prospectief verzameld op meerdere tijdstippen. De nalevingspercentages waren 70% tot 94%. Er was een omgekeerde relatie tussen vermoeidheid en socialefunctioneren onder volwassenen. De verbetering van de kwaliteit van leven (KvL) en het vermogen om PRO’s te voltooien, waren gekoppeld aan de ziektestatus. Ongeveer 40% van de volwassenen meldde op zijn minst enige cognitieve problemen, met een nadelige invloed op de mentale en fysieke gezondheidstoestand. Bij volwassenen waren geheugenproblemen de meest gemelde cognitieve stoornis.

Depressie ging gepaard met cognitieve problemen . Jongere volwassenen hadden een hoger risico op langdurige slechte geestelijke gezondheid, angst en depressie. Bij pediatrische en adolescente patiënten verbetert de emotionele disfunctie in de loop van de tijd. KvL-status verbeterde in de loop van de tijd; toch veroorzaakten ernstig cytokine-afgiftesyndroom en neurotoxiciteit een vertraagde verbetering. Informatie over de vraag of de PRO’s zijn geïntegreerd in medische dossiers en klinische richtlijnen ontbreekt. Het gebruik van PRO’s bij patiënten met CAR T -celtherapie lijkt haalbaar en informatief. Research met grotere steekproefomvang en het gebruik van gevalideerde PRO-tools op verschillende tijdstippen blijven onvervulde behoeften.


Related Post

Leave a Reply

Your email address will not be published. Required fields are marked *